SOS T-shirts?

[baywatch]

Is there a section to order t-shirts, can koozies, and Other SOS merchandise?

For what it is worth I think a T-shirt with just the Logo that is at the the top of the page would be cool.

[stecz20]

Is there a section to order t-shirts, can koozies, and Other SOS merchandise?

For what it is worth I think a T-shirt with just the Logo that is at the the top of the page would be cool.

working on it...

[inbetween]

losing patients here











:03::03::03:

[stecz20]

losing patients here











:03::03::03:



great... thanks for sharing....:seeya::seeya:

[Bobcat]

losing patients here











:03::03::03:

are you a doctor? patience my friends patience(plus we had to send the first bunch of stuff back to the manufacturers ,nobody wanted a shirt/coozie with stecz's dna on it:()

[phragle]

Red dog and I take care of the patients around here...

[yesrej]

good things are comming. good things take time...

[inbetween]

are you a doctor? patience my friends patience(plus we had to send the first bunch of stuff back to the manufacturers ,nobody wanted a shirt/coozie with stecz's dna on it:()

Hey at least someone was paying attention :sifone:
As cool as the apparel looked in those KW pics, I'd take it with the dna :rofl:

All joking aside, that stuff looks great and will be worth the wait.

[Trim'd Up]

I'll take mine DNA free, thanks.

[phragle]

I know how to do the DNA testing you see on CSI... but Im not touching that.....

[Chris]

Next week I'm going to go thru what's left from Key West and we'll offer them on a first-come, first-served basis. New designs are already in the works.

[ChiefApache]

Can't wait! Coozies....coozies.....coozies.....

[MarylandMark]

Next week I'm going to go thru what's left from Key West and we'll offer them on a first-come, first-served basis. New designs are already in the works.

It looks like I am 1st in line?

Sweeet!!

:biggrinjester:

I wonder if the one I have now will be considered a classic and collectible one day

[Bobcat]

If you puked on it after drinking too much,it is a classic, if you wore it in the pool while swimming with dolphins, not so much.:03:

[Speedpro1]

It looks like I am 1st in line?

Sweeet!!

:biggrinjester:

I wonder if the one I have now will be considered a classic and collectible one day

I don't know about a collectible, but by the way they are going it will sure be a classic.
:biggrinjester:

[MarylandMark]

If you puked on it after drinking too much,it is a classic, if you wore it in the pool while swimming with dolphins, not so much.

Puking is for puzzies! :ack2:

Chunky guy stuffed in a wetsuit getting a dolphin kiss = Chick Magnet! :rofl:

[Bobcat]

you better hope stecz doesn't see this!!:leaving:

[MarylandMark]

I'm one of his people and he said it was ok as long as I didn't touch her blowhole

:cool:

[Seltzer]

Puking is for puzzies! :ack2:

Chunky guy stuffed in a wetsuit getting a dolphin kiss = Chick Magnet! :rofl:

I had to register just to call you a ***.

[Bobcat]

does that start with an f ?

[Sea-Dated]

Followed by an

ag

[sellsman11]

I had to register just to call you a ***.


HOly chit....THAT is FUNNY!!!:biggrinjester::biggrinjester:

[Buoy]

If you puked on it after drinking too much,it is a classic, if you wore it in the pool while swimming with dolphins, not so much.:03:

I love it!!!

Hey MM - I need to talk to you about something.
You gonna be around tomorrow??
I still have your # if it has changed from the one with the 2's.

[MarylandMark]

I had to register just to call you a ***.

Don't be a hater....


I still have your # if it has changed from the one with the 2's.

That's it- same # since 10th grade. All the non-emergency police numbers in my entire country end in 2222 so 1st time I call anyone they shart themselves.

Call whenever- no appointment needed... :rofl:

[Buoy]

Just got home -
dialing as I type.

[Buoy]

Thanks Mark.
Good talking to ya!
I'll keep you posted.

[MarylandMark]

Ditto dude!


:cheers2:

[Bobcat]

****!

[Buoy]

****!

Care to elaborate on that?

[Bobcat]

does that start with an f ?


followed by an

ag

:26:

[Bobcat]

I'll go poof myself!

[Buoy]

I'll go poof myself!

Hey man, what you do in your spare time alone is up to you, call it what you want...

[BradB]

Next week I'm going to go thru what's left from Key West and we'll offer them on a first-come, first-served basis. New designs are already in the works.



Do you have any giant size left????

[MarylandMark]

It looks like I am 1st in line?

:smash:

Back on topic about my free revised logo shirts

[Seltzer]

Sign me up.
Ill even pay for a shirt.

[MarylandMark]

Sign me up. Ill even pay for a shirt.

I have a never worn classic polo and classic T going to the highest bidder :)

If you are the high bidding and only 2 spots down I'll reduce shipping to $29.99 (union rate to walk it over).

For an extra 50% I'll wear them to make it an authentic MarylandMark™ merchandise. 50% extra on that to have them autographed.

Bid early and bid high! :rofl:

[Tommy Gun]

are you a doctor? patience my friends patience(plus we had to send the first bunch of stuff back to the manufacturers ,nobody wanted a shirt/coozie with stecz's dna on it:()

What does the DNA of a steamer look like?

[Chris]

I have a never worn classic polo and classic T going to the highest bidder :)

If you are the high bidding and only 2 spots down I'll reduce shipping to $29.99 (union rate to walk it over).

For an extra 50% I'll wear them to make it an authentic MarylandMark™ merchandise. 50% extra on that to have them autographed.

Bid early and bid high! :rofl:

As an extra, added feature, the shirts you'll receive from Mark will have authentic MarylandMark blood splatter on them. He'll also have a pair of slightly soiled shirts with an authentic Chris footprint on the ass.
;)

[MarylandMark]

Edit- not longer for sale... :gnorsi:

:rofl:

[Bobcat]

What does the DNA of a steamer look like?

the lab guys will not say:sifone:

[ItsPeanut]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

[stecz20]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

i dont really understand your post???

[MarylandMark]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

STFU...

LOL- just kidding dude.

Bouy = talked to him on the phone just the other night. He likes busting my balls a bit and good comradely

Seltzer= I watch his wife shower thru the windows since he has a summer home 2 doors down from mine

Chris= saw me drink copious amounts of booze, stumble all over the place and not remember what happened or what was said for a week straight

bobcat= just met him in Key West last week he likes busting balls

Stecz= the leader

and so on...

This site may be new but some of the donkey's on it aren't and we have like to have fun- it's all good..

[stecz20]

the reason why this site atsrted is cause the fun was gone from oso... its winter time, and this is what the boards are about.. ball breaking and some inbetween boating stuff... tough times are here for some and i dont see a better way to get togetehr with your buds and break some balls.... the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual..... that will be all, carry on you pigs.....

we still have so much to bring you people, its only the begining... poor sunkin, were gonna bleed his ass dry.... big things are still coming, wait and see.. key west was small potatoes.......

[inbetween]

the reason why this site atsrted is cause the fun was gone from oso... and some inbetween boating ...

Aww shucks. Thanks guys. :seeya::biggrinjester::26::seeya:


FANTASTIC site. glad to be a part of it. Still waiting to order shirts though.:03:

[yesrej]

the reason why this site atsrted is cause the fun was gone from oso... its winter time, and this is what the boards are about.. ball breaking and some inbetween boating stuff... tough times are here for some and i dont see a better way to get togetehr with your buds and break some balls.... the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual..... that will be all, carry on you pigs.....

we still have so much to bring you people, its only the begining... poor sunkin, were gonna bleed his ass dry.... big things are still coming, wait and see.. key west was small potatoes.......

you are 100% right. we need to get drunk soon.

[Seltzer]

Seltzer= I watch his wife shower thru the windows since he has a summer home 2 doors down from mine

I always wondered why that milk crate kept showing up at the window.

[ILMORdude]

I need some coozies for my party school bus! Can never have enough of those bastards. Maybe a bigass SOS banner for the sides and rock em around the michigan poker runs! Hah

[cosmic12]

[QUOTE=Stecz20;21247] the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual....

QUOTE]

I haven't seen a dime yet or even a T-Shirt, pay up or we will have to start enforceing the new rules.:03: Pay UP and soon!!!:26::26::03::26::03:

[stecz20]

[QUOTE=Stecz20;21247] the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual....

QUOTE]

I haven't seen a dime yet or even a T-Shirt, pay up or we will have to start enforceing the new rules.:03: Pay UP and soon!!!:26::26::03::26::03:

When the world is mine, your death will be quick and painless... :03::03::03:

[phragle]

what does the dna of a steamer look like?

ccatgtggacctttgcaacctggctaacacacttgcctaagcgcgacgataattta
ggtacacctggaaacgttggaccgattgtgtgaacggattcgcgctgctattaaat

[NJgr8ful]

I need some shirts .. traveling to FL soon and need to fly our new colors

2XXLT few different colors

[stecz20]

I need some shirts .. traveling to FL soon and need to fly our new colors

2XXLT few different colors

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

[cosmic12]

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

Wait a min,Im still waiting payment. Mine first:sifone:

[NJgr8ful]

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

Sure, thought they woulda been here already :03:

((SERIOUSLY (get it?) though, I want to pay for them!! Not freebees like you Key West mooches got :D I just want .. NEED .. some shirts!!))

[stecz20]

Sure, thought they woulda been here already :03:

((SERIOUSLY (get it?) though, I want to pay for them!! Not freebees like you Key West mooches got :D I just want .. NEED .. some shirts!!))

we are wroking on it.... we just some things to do that are a little more imortant than t shirts for right now.. but we do promise, we will have some t shirts and such as soon as we can.... we promise..

[Bobcat]

until then we will establish an exchange program, everyone gets a shirt for one week , washing it is optional, one size fits all....................................:(